Database '3D-footprint 20260701' (DNA Binding Motifs 251-300)
If you want to search for an specific entry use the Search Entry Form.If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.
Pages: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31
| Accessions | Names | Consensus | Organisms | Description and notes |
|---|---|---|---|---|
| 6p0t_B | DNA-binding protein Fis | TgTntT | Escherichia coli strain K12 | Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli
|
| 6p0u_ABEF | DNA-binding protein Fis | AnnnnTGTGTTnnnnACMGCC | Escherichia coli strain K12 | Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E.
|
| 4rb1_AB | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | CGATnnnnnTnnTnnnnnT | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 Fur-Mn2+-E. coli Fur box |
| 4rb1_B | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | cGAt | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 Fur-Mn2+-E. coli Fur box |
| 4rb2_CD | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | TnnnTGCAAAnnnTnTGC | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 SeMet-Fur-Mn2+-feoAB1 operator |
| 4rb2_D | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | TTTGCAnntA | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 SeMet-Fur-Mn2+-feoAB1 operator |
| 4rb3_CD | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | TGCAAAnnnTTTGCAnnnA | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 Fur-Mn2+-feoAB1 operator |
| 4rb3_D | DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport(Fur family) | TnnnTGCAAA | Magnetospirillum gryphiswaldense strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 | Crystal structure of Magnetospirillum gryphiswaldense MSR-1 Fur-Mn2+-feoAB1 operator |
| 4s04_B | DNA-binding transcriptional regulator BasR | TAAGCAAG | Klebsiella pneumoniae JM45 | Crystal structure of Klebsiella pneumoniae PmrA in complex with PmrA
|
| 4s04_EF | DNA-binding transcriptional regulator BasR | TWAtnTTannnTAAGnAA | Klebsiella pneumoniae JM45 | Crystal structure of Klebsiella pneumoniae PmrA in complex with PmrA
|
| 4s05_A | DNA-binding transcriptional regulator BasR | TtAAt | Klebsiella pneumoniae JM45 | Crystal structure of Klebsiella pneumoniae PmrA in complex with PmrA
|
| 4s05_AB | DNA-binding transcriptional regulator BasR | CtTAGnnnannATTaA | Klebsiella pneumoniae JM45 | Crystal structure of Klebsiella pneumoniae PmrA in complex with PmrA
|
| 4nhj_A | DNA-binding transcriptional regulator RstA | GAaTGTACA | Klebsiella pneumoniae subsp. pneumoniae strain ATCC 700721 / MGH 78578 | Crystal structure of Klebsiella pneumoniae RstA DNA-binding domain in complex
|
| 4nhj_AB | DNA-binding transcriptional regulator RstA | TGtACAnnCCGTkrCT | Klebsiella pneumoniae subsp. pneumoniae strain ATCC 700721 / MGH 78578 | Crystal structure of Klebsiella pneumoniae RstA DNA-binding domain in complex
|
| 1zlk_A | Dormancy Survival Regulator | aGTCCCt | Mycobacterium tuberculosis strain ATCC 25618 / H37Rv | Crystal Structure of the Mycobacterium tuberculosis Hypoxic Response Regulator DosR
|
| 1zlk_AB | Dormancy Survival Regulator | AGGGACTnnAGTCCC | Mycobacterium tuberculosis strain ATCC 25618 / H37Rv | Crystal Structure of the Mycobacterium tuberculosis Hypoxic Response Regulator DosR
|
| 5z2t_CD | Double homeobox protein 4 | TTAsaTTA | Homo sapiens | Crystal structure of DNA-bound DUX4-HD2 |
| 5z2t_D | Double homeobox protein 4 | TAAt | Homo sapiens | Crystal structure of DNA-bound DUX4-HD2 |
| 5z6z_A | Double homeobox protein 4 | TGATtAgATTAG | Homo sapiens | Crystal structure of human DUX4 homeodomains bound to DNA |
| 6a8r_A | Double homeobox protein 4 | rTCA | Homo sapiens | Crystal structure of DUX4 HD2 domain associated with ERG DNA
|
| 6dfy_C | Double homeobox protein 4 | AGAnAA | Homo sapiens | Remodeled crystal structure of DNA-bound DUX4-HD2 |
| 6dfy_CD | Double homeobox protein 4 | TnATCTnATC | Homo sapiens | Remodeled crystal structure of DNA-bound DUX4-HD2 |
| 6e8c_A | Double homeobox protein 4 | TTGATnAnATTAC | Homo sapiens | Crystal structure of the double homeodomain of DUX4 in complex
|
| 6u81_A | Double homeobox protein 4 | ctaATCAA | Homo sapiens | Crystal Structure of the Double Homeodomain of DUX4 in Complex
|
| 6u82_D | Double homeobox protein 4 | CTAATCTanTCA | Homo sapiens | Crystal Structure of the Double Homeodomain of DUX4 in Complex
|
| 5zfw_A | Double homeobox protein 4-like protein 4 | CTAATCTnaTCA | Homo sapiens | Crystal structure of human DUX4 homeodomains bound to A11G DNA
|
| 5zfy_A | Double homeobox protein 4-like protein 4 | CTAATCTntTCA | Homo sapiens | Crystal structure of human DUX4 homeodomains bound to A12C DNA
|
| 5zfz_A | Double homeobox protein 4-like protein 4 | TGAAnaGATTAG | Homo sapiens | Crystal structure of human DUX4 homeodomains bound to A12T DNA
|
| 4yj0_ABC | Doublesex- and mab-3-related transcription factor 1 | ATACAnTGTTG | Homo sapiens | Crystal structure of the DM domain of human DMRT1 bound
|
| 4yj0_C | Doublesex- and mab-3-related transcription factor 1 | TGTTG | Homo sapiens | Crystal structure of the DM domain of human DMRT1 bound
|
| 1a1g_A | DSNR ZINC FINGER PEPTIDE | GCCCaCGC | Mus musculus | DSNR (ZIF268 VARIANT) ZINC FINGER-DNA COMPLEX (GCGT SITE) |
| 4qtr_CD | dualENH | aAnnnnnTt | Computational design of co-assembling protein-DNA nanowires | |
| 1p47_AB | Early growth response protein 1 | GGCGTGGGCGGCGTGGGCGT | Mus musculus | Crystal Structure of tandem Zif268 molecules complexed to DNA |
| 1p47_B | Early growth response protein 1 | gGCGTGGGCGT | Mus musculus | Crystal Structure of tandem Zif268 molecules complexed to DNA |
| 4r2a_A | Early growth response protein 1 | GCGTGGGcg | Homo sapiens | Egr1/Zif268 zinc fingers in complex with methylated DNA |
| 4r2c_A | Early growth response protein 1 | GCGTGGGGt | Homo sapiens | Egr1/Zif268 zinc fingers in complex with hydroxymethylated DNA |
| 4r2d_A | Early growth response protein 1 | AGCCCACGC | Homo sapiens | Egr1/Zif268 zinc fingers in complex with formylated DNA |
| 4x9j_A | Early growth response protein 1 | annCCCAnnC | Homo sapiens | EGR-1 with Doubly Methylated DNA |
| 1r0n_B | Ecdysone receptor | TgaCC | Drosophila melanogaster | Crystal Structure of Heterodimeric Ecdsyone receptor DNA binding complex |
| 1r0o_B | Ecdysone receptor | TgaCC | Drosophila melanogaster | Crystal Structure of the Heterodimeric Ecdysone Receptor DNA-binding Complex |
| 5zx2_F | ECF RNA polymerase sigma factor SigH | GGGTnTACcACnnnnnnnnnnnnnnnGTnCC | Mycobacterium tuberculosis strain ATCC 25618 / H37Rv | Mycobacterium tuberculosis RNA polymerase transcription initiation complex with ECF sigma
|
| 6jhe_A | ECF RNA polymerase sigma factor SigW | GTtTCA | Bacillus subtilis strain 168 | Crystal Structure of Bacillus subtilis SigW domain 4 in complexed
|
| 6jbq_F | ECF RNA polymerase sigma-E factor | CGGAACTnnnnnnnnnnnnnAnTGTCnnAnC | Escherichia coli strain K12 | CryoEM structure of Escherichia coli sigmaE transcription initiation complex containing
|
| 4umm_AE | ECR-USP | GTtCAntnnAC | Heliothis virescens Tobacco budworm moth | The Cryo-EM structure of the palindromic DNA-bound USP-EcR nuclear receptor
|
| 4wzs_D | ECU04_1440 protein | CTTTTATAG | Encephalitozoon cuniculi (strain GB-M1) Microsporidian parasite | Crystal structure of the Mot1 N-terminal domain in complex with
|
| 3hdd_AB | ENGRAILED HOMEODOMAIN | GTAATAACnTTA | Drosophila melanogaster | ENGRAILED HOMEODOMAIN DNA COMPLEX |
| 5t7x_AB | Epstein-Barr nuclear antigen 1 | GGATAGCnnntGcTACCC | Epstein-Barr virus (strain GD1) (HHV-4) Human herpesvirus 4 | Crystal structure of HHV-4 EBNA1 DNA binding domain (patient-derived, nasopharyngeal
|
| 5t7x_B | Epstein-Barr nuclear antigen 1 | GGATAgc | Epstein-Barr virus (strain GD1) (HHV-4) Human herpesvirus 4 | Crystal structure of HHV-4 EBNA1 DNA binding domain (patient-derived, nasopharyngeal
|
| 6pw2_ABCD | Epstein-Barr nuclear antigen 1 | ATAGCnnnTnTTnCCCnnnGGGnAGmnnnnnCTATC | Epstein-Barr virus (strain B95-8) (HHV-4) Human herpesvirus 4 | Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr
|
| 6pw2_B | Epstein-Barr nuclear antigen 1 | GATAGca | Epstein-Barr virus (strain B95-8) (HHV-4) Human herpesvirus 4 | Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr
|
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.
