DNA Binding Motif
Accessions: | 1p47_AB (3D-footprint 20241219) |
Names: | Early growth response protein 1 |
Organisms: | Mus musculus |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Description: | Crystal Structure of tandem Zif268 molecules complexed to DNA |
Length: | 20 |
Consensus: | GGCGTGGGCGGCGTGGGCGT |
Weblogo: | ![]() |
PSSM: | P0 A C G T 01 5 6 80 5 G 02 0 0 96 0 G 03 0 90 1 5 C 04 0 0 96 0 G 05 6 5 5 80 T 06 0 0 96 0 G 07 0 0 96 0 G 08 0 0 96 0 G 09 0 96 0 0 C 10 0 0 96 0 G 11 0 0 96 0 G 12 5 80 5 6 C 13 0 0 96 0 G 14 5 0 6 85 T 15 0 0 96 0 G 16 0 0 96 0 G 17 0 0 96 0 G 18 6 80 5 5 C 19 0 0 96 0 G 20 5 5 6 80 T |
Type: | Heterodimer |
Binding TFs: | 1p47_A (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger) 1p47_B (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger) |
Binding Sites: | 1p47_C 1p47_D |
Publications: | Peisach E, Pabo C.O. Constraints for zinc finger linker design as inferred from X-ray crystal structure of tandem Zif268-DNA complexes. Journal of molecular biology 330:1-7 (2003). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.