Database '3D-footprint 20241219' (DNA Binding Motifs 1501-1550)
If you want to search for an specific entry use the Search Entry Form.If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.
Pages: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31
Accessions | Names | Consensus | Organisms | Description and notes |
---|---|---|---|---|
4r2e_A | Wilms tumor protein, isoform 4/CRA_a | GCGTGGGcGG | Homo sapiens | Wilms Tumor Protein (WT1) zinc fingers in complex with methylated ![]() |
4r2p_A | Wilms tumor protein, isoform 4/CRA_a | gCGTGGGGt | Homo sapiens | Wilms Tumor Protein (WT1) zinc fingers in complex with hydroxymethylated ![]() |
4r2q_A | Wilms tumor protein, isoform 4/CRA_a | aGCCCACGC | Homo sapiens | Wilms Tumor Protein (WT1) zinc fingers in complex with formylated ![]() |
4r2r_A | Wilms tumor protein, isoform 4/CRA_a | AGCCCACGC | Homo sapiens | Wilms Tumor Protein (WT1) zinc fingers in complex with carboxylated ![]() |
4r2s_A | Wilms tumor protein, isoform 4/CRA_a | annCCCACGC | Homo sapiens | Wilms Tumor Protein (WT1) Q369P zinc fingers in complex with![]() |
6fix_ABDE | XRE family transcriptional regulator | ACnnnTaAnnTTAAnnnTT | Pseudomonas putida | antitoxin GraA in complex with its operator |
6fix_D | XRE family transcriptional regulator | tTAa | Pseudomonas putida | antitoxin GraA in complex with its operator |
1jk1_A | ZIF268 | cCGCCCaCGC | Mus musculus | Zif268 D20A Mutant Bound to WT DNA Site |
1jk2_A | ZIF268 | GCGtGGGC | Mus musculus | Zif268 D20A mutant bound to the GCT DNA site |
6ml2_A | Zinc finger and BTB domain-containing protein 24 | cAGGTCCtGG | Mus musculus | ZBTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 1) |
6ml3_A | Zinc finger and BTB domain-containing protein 24 | CTTCCAGGACCTg | Mus musculus | ZBTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 2) |
6ml4_A | Zinc finger and BTB domain-containing protein 24 | CGTCCAGGACCTg | Mus musculus | BTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 3) |
6ml5_A | Zinc finger and BTB domain-containing protein 24 | cAGGTCCTGgACG | Mus musculus | ZBTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 4) |
6ml6_A | Zinc finger and BTB domain-containing protein 24 | CGTCCAGGACCT | Mus musculus | ZBTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 4![]() |
6ml7_A | Zinc finger and BTB domain-containing protein 24 | AGGTCCTGGAmGa | Mus musculus | ZBTB24 Zinc Fingers 4-8 with 19+1mer DNA Oligonucleotide (Sequence 4![]() |
3uk3_C | Zinc finger protein 217 | TTCTGCA | Homo sapiens | Crystal structure of ZNF217 bound to DNA |
3uk3_CD | Zinc finger protein 217 | TGCAGAATnnATTCTGCA | Homo sapiens | Crystal structure of ZNF217 bound to DNA |
4f2j_C | Zinc finger protein 217 | TGcaG | Homo sapiens | Crystal structure of ZNF217 bound to DNA, P6522 crystal form |
4is1_CD | Zinc finger protein 217 | TGCAGAATnnATTCTGCA | Homo sapiens | Crystal structure of ZNF217 bound to DNA |
4is1_D | Zinc finger protein 217 | TGCAGAAT | Homo sapiens | Crystal structure of ZNF217 bound to DNA |
5v3j_F | Zinc finger protein 568 | GGCGTGGCACAGGTAAAAAGGGC | Mus musculus | mouseZFP568-ZnF1-10 in complex with DNA |
5v3m_C | Zinc finger protein 568 | GcCCTyntTACCTGTGCCACGCC | Mus musculus | mouseZFP568-ZnF1-11 in complex with DNA |
5wjq_D | Zinc finger protein 568 | TGGnCGTGGCaCrGGTaAnwAGGG | Mus musculus | mouseZFP568-ZnF2-11 in complex with DNA |
4gzn_C | Zinc finger protein 57 | TGCGGCA | Mus musculus | Mouse ZFP57 zinc fingers in complex with methylated DNA |
4m9v_C | Zinc finger protein 57 | TGCGCA | Mus musculus | Zfp57 mutant (E182Q) in complex with 5-carboxylcytosine DNA |
2kmk_A | Zinc finger protein Gfi-1 | GGcAtTGAT | Rattus norvegicus | Gfi-1 Zinc Fingers 3-5 complexed with DNA |
5yi2_AB | Zinc transport transcriptional regulator | TTaAAnAGTTAAA | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, wild type in complex with ![]() |
5yi2_EF | Zinc transport transcriptional regulator | TtaACnAGTTAA | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, wild type in complex with ![]() |
5yi2_IJ | Zinc transport transcriptional regulator | TwAACyrGTTAA | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, wild type in complex with ![]() |
5yi2_J | Zinc transport transcriptional regulator | rGTtAA | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, wild type in complex with ![]() |
5yi3_I | Zinc transport transcriptional regulator | TTAACT | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, C30S mutant in complex with ![]() |
5yi3_MN | Zinc transport transcriptional regulator | TTAACTnGTTaA | Lactococcus lactis Lactococcus lactis subsp. lactis (strain IL1403) | Structure of Lactococcus lactis ZitR, C30S mutant in complex with ![]() |
4mtd_ABCD | Zinc uptake regulation protein | TGAaATGTTATAAyATnACA | Escherichia coli strain K12 | Zinc Uptake Regulator Complexed With Zinc AND DNA |
4mtd_B | Zinc uptake regulation protein | TATAATA | Escherichia coli strain K12 | Zinc Uptake Regulator Complexed With Zinc AND DNA |
4mte_ABCD | Zinc uptake regulation protein | TGAnATGnTATAATATCACA | Escherichia coli strain K12 | Zinc Uptake Regulator Complexed with Zinc and DNA |
4mte_D | Zinc uptake regulation protein | TATcACA | Escherichia coli strain K12 | Zinc Uptake Regulator Complexed with Zinc and DNA |
5szx_AB | Zta transcription factor | tTGCTCA | Epstein-Barr virus (strain B95-8) (HHV-4) Human herpesvirus 4 | Epstein-Barr virus Zta DNA binding domain homodimer in complex with![]() |
1h89_C | tCCGTTa | |||
1h8a_C | TCCGTTA | |||
4fx4_B | TACACGnAT | |||
4roc_A | GGnnnnnnnnnnnGTG | |||
4rod_A | GAnnnnnnnnnnnCTG | |||
4roe_A | AGnnnnnnnnnnnTTC | |||
5ze0_C | ACnnnnnnnnnnnnnnnnnnTnnaG | |||
6oen_C | GnGntnnnnnnnnnnAC | |||
6oeo_C | CACnnnnnnnnnnnnnnnnnnnnnag | |||
6oeo_CD | ctnnnnnnnnnnnnnnnnnnnnnGTG | |||
6p0s_E | GkcnGTT | |||
6p0u_E | ACnGACnACA | |||
6y93_B | GGaAATa |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.