DNA Binding Motif
Accessions: | 5v3j_F (3D-footprint 20241219) |
Names: | Zinc finger protein 568 |
Organisms: | Mus musculus |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Description: | mouseZFP568-ZnF1-10 in complex with DNA |
Length: | 23 |
Consensus: | GGCGTGGCACAGGTAAAAAGGGC |
Weblogo: | ![]() |
PSSM: | P0 A C G T 01 8 8 72 8 G 02 0 0 96 0 G 03 0 96 0 0 C 04 0 0 96 0 G 05 0 0 0 96 T 06 0 0 96 0 G 07 0 0 96 0 G 08 8 88 0 0 C 09 88 0 8 0 A 10 0 96 0 0 C 11 96 0 0 0 A 12 0 0 96 0 G 13 0 0 96 0 G 14 0 0 0 96 T 15 96 0 0 0 A 16 96 0 0 0 A 17 72 8 8 8 A 18 72 8 8 8 A 19 96 0 0 0 A 20 0 0 96 0 G 21 0 0 96 0 G 22 0 0 96 0 G 23 0 96 0 0 C |
Binding TFs: | 5v3j_F (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger, C2H2-type zinc finger) |
Binding Sites: | 5v3j_C 5v3j_D |
Publications: | Patel A, Yang P, Tinkham M, Pradhan M, Sun MA, Wang Y, Hoang D, Wolf G, Horton JR, Zhang X, Macfarlan T, Cheng X. DNA Conformation Induces Adaptable Binding by Tandem Zinc Finger Proteins. Cell 173:221-233 (2018). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.