Database 'EEADannot 2026-03-04' (DNA Binding Motifs 251-300)
If you want to search for an specific entry use the Search Entry Form.If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.
Pages: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
| Accessions | Names | Consensus | Organisms |
|---|---|---|---|
| EEAD0324 | CA2P13_CA3P4_CA5P7_Mo17_1 | tcvACCAATCasrtg | Zea mays |
| EEAD0567 | CACG | CACG | Hordeum vulgare |
| EEAD0599 | Carub.0001s0116.1_MYBRELATED_3_AT1G01060 | rGATATTT | Capsella rubella |
| EEAD0600 | Carub.0001s1194.1_NAC_2_AT1G12260 | CkTrarawwyAMGyAAhm | Capsella rubella |
| EEAD0601 | Carub.0001s1299.1_RAV_1_AT1G13260 | AAcArAAAwCACCTGA | Capsella rubella |
| EEAD0602 | Carub.0001s3581.1.p_AP2EREBP_1_AT1G46768 | TGTCGGTG | Capsella rubella |
| EEAD0603 | Carub.0002s1646.1_HOMEOBOX_1_AT1G69780 | yAATTATTrww | Capsella rubella |
| EEAD0604 | Carub.0002s1959.1_MYBRELATED_1_AT1G72740 | CCCTAAACCCTAAACCCTAAACCCTAAA | Capsella rubella |
| EEAD0605 | Carub.0002s2128.1_RWPRK_1_AT1G74480 | rrGAAGwyGAAmsGT | Capsella rubella |
| EEAD0606 | Carub.0002s2670.1_WRKY_1_AT1G80840 | rGTCAAmr | Capsella rubella |
| EEAD0607 | Carub.0003s1161.1.p_BZIP_2_AT3G12250 | TGmTGACGTCAyc | Capsella rubella |
| EEAD0608 | Carub.0003s3279.1_HOMEOBOX_1_AT2G18550 | wwwwwwdwayCAATwATTGrw | Capsella rubella |
| EEAD0609 | Carub.0004s2291.1_BZIP_3_AT2G40620 | gMMRGCTGkCA | Capsella rubella |
| EEAD0610 | Carub.0004s2803.1_LOBAS2_1_AT2G45420 | TsCGGtTTTksCGGr | Capsella rubella |
| EEAD0611 | Carub.0004s2898.1.p_BZIP_1_AT2G46270 | tGmtGACGTGGMA | Capsella rubella |
| EEAD0612 | Carub.0004s2981.1_SBP_1_AT2G47070 | tGTACGGA | Capsella rubella |
| EEAD0613 | Carub.0005s0004.1_G2LIKE_1_AT2G01060 | adraarGAATATTCy | Capsella rubella |
| EEAD0614 | Carub.0005s0095.1_BBRBPC_1_AT2G01930 | GAGAGAGArAr | Capsella rubella |
| EEAD0615 | Carub.0005s0520.1_TCP_1_AT3G27010 | wGGKkRKwCCYACrk | Capsella rubella |
| EEAD0616 | Carub.0006s0445.1_TRIHELIX_4_AT5G05550 | CrCCGGMr | Capsella rubella |
| EEAD0617 | Carub.0007s0775.1_MYB_1_AT4G32730 | AACGGYyAyww | Capsella rubella |
| EEAD0618 | Carub.0008s0039.1_MYBRELATED_2_AT5G47390 | wwTGGATAAgrwTra | Capsella rubella |
| EEAD0619 | Carub.0008s0285.1_BES1_1_AT5G45300 | srCACGTGTGA | Capsella rubella |
| EEAD0620 | Carub.0008s2269.1_ARF_1_AT5G62000 | tTGTCGSswwwwmrssrACA | Capsella rubella |
| EEAD0562 | CBF12C_1 | wwryATGTCGGCAvsy | Hordeum vulgare |
| EEAD0152 | ChCUC1-chipseq | CTCsRCCr | Cardamine hirsuta |
| EEAD0153 | ChCUC1-dapseq | CAmGyAA | Cardamine hirsuta |
| EEAD0165 | ChFLCmeme | tMyaaAAWWrGAAAg | Crucihimalaya himalaica |
| EEAD0164 | ChFLCrsat | awATAGAAAGww | Crucihimalaya himalaica |
| EEAD0163 | ChFLMmeme | wcTTTCYwWTTttGk | Crucihimalaya himalaica |
| EEAD0162 | ChFLMrsat | wwaCAAAACaww | Crucihimalaya himalaica |
| EEAD0059 | CLSY3 | TTGCTTATrTTTTGCTTA | Arabidopsis thaliana |
| EEAD0072 | CmMAF2 | CwwAwwAAwG | Chrysanthemum x morifolium |
| EEAD0073 | CmWIP1 | wwACCTTGAttww | Cucumis melo |
| EEAD0156 | CO-NF-trimer | YCACA | Arabidopsis thaliana |
| EEAD0007 | CONS1 | TGTGnnATG | Arabidopsis thaliana |
| EEAD0008 | CONS2 | TGTGnnnATG | Arabidopsis thaliana |
| EEAD0078 | CORE | TCACA | Arabidopsis thaliana |
| EEAD0081 | CRL1BOX | CACAmm | Oryza sativa |
| EEAD0150 | CsMYB60-dreme | ACCTAmy | Cucumis sativus |
| EEAD0149 | CsMYB60-memechip | yyTACCwAmyw | Cucumis sativus |
| EEAD0566 | CTGTCA | CTGTCA | Capsella rubella |
| EEAD0076 EEAD0077 | CURE3UTR1, CURE3UTR2 | TCTCTCTCTy | Oryza sativa |
| EEAD0058 | DcWRKY75 | AGAAkbT | Dianthus caryophyllus |
| EEAD0560 EEAD0561 | DiBS, DiBSZm | TACArT | Arabidopsis thaliana Zea mays |
| EEAD0325 | DOF1_PBF1_B73_2_m1 | TkACTTTTyrsygtw | Zea mays |
| EEAD0326 | DOF1_PBF1_Mo17_1 | acrsyaAAAAGkwAm | Zea mays |
| EEAD0327 | DOF24_B73_2_m1 | wkAmaGywvCTTTTT | Zea mays |
| EEAD0328 | DOF24_Mo17_1 | wtAMAGYwmCTTTTy | Zea mays |
| EEAD0168 | EBS | ddbThKATWCAwTGh | Dianthus caryophyllus |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.