DNA Binding Site

Accessions: 4y5w_F (3D-footprint 20231221), 4y5w_N (3D-footprint 20231221)
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: TCTGTCTTCCTAGGAAATCCAT
Type: Heterodimer
Binding TFs: 4y5w_B (SH2 domain, STAT protein, all-alpha domain, STAT protein, DNA binding domain)
4y5w_C (SH2 domain, STAT protein, all-alpha domain, STAT protein, DNA binding domain)
4y5w_D (SH2 domain, STAT protein, all-alpha domain, STAT protein, DNA binding domain)
Binding Motifs: 4y5w_AC CCnnGGAAnnnnnA
4y5w_B GgAannnnnA
4y5w_BD TTCnngg
Publications: Li J, Rodriguez JP, Niu F, Pu M, Wang J, Hung LW, Shao Q, Zhu Y, Ding W, Liu Y, Da Y, Yao Z, Yang J, Zhao Y, Wei GH, Cheng G, Liu ZJ, Ouyang S. Structural basis for DNA recognition by STAT6. Proc Natl Acad Sci U S A 113:13015-13020 (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.