DNA Binding Site

Accessions: 6lc1_L (3D-footprint 20231221)
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: CCTGGCATTTGGAGGTAAATATCAC
Type: Heterodimer
Binding TFs: 6lc1_G (Zinc finger, C4 type (two domains))
6lc1_J (Zinc finger, C4 type (two domains))
Binding Motifs: 6lc1_G gTAnaTAnnA
6lc1_GJ TGnCATnTgnnnGTAnATAnnA
Publications: Jiang L, Wei H, Yan N, Dai S, Li J, Qu L, Chen X, Guo M, Chen Z, Chen Y. Structural basis of NR4A1 bound to the human pituitary proopiomelanocortin gene promoter. Biochem Biophys Res Commun 523:1-5 (2020). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.