DNA Binding Site
Accessions: | 5fur_F (3D-footprint 20231221), 6mzm_U (3D-footprint 20231221) |
Organisms: | Homo sapiens |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 80 |
Sequence: | CCGTAGGCACGTCTGCTCGGCTCGAGTGTTCGATCGCGACTGAGGACGAACGCGCCCCCA CCCCCTTTTATAGGCGCCCT |
Binding TFs: | 5fur_A / 6mzm_T (Transcription factor TFIID (or TATA-binding protein, TBP)) |
Binding Motifs: | 5fur_ACGI CTTTTATA 6mzm_ABTW TATAAAAGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCnnnCnGA |
Publications: | Louder RK, He Y, López-Blanco JR, Fang J, Chacón P, Nogales E. Structure of promoter-bound TFIID and model of human pre-initiation complex assembly. Nature 531:604-9 (2016). [Pubmed] Patel AB, Louder RK, Greber BJ, Grünberg S, Luo J, Fang J, Liu Y, Ranish J, Hahn S, Nogales E. Structure of human TFIID and mechanism of TBP loading onto promoter DNA. Science : (2018). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.