DNA Binding Site
Accessions: | 3fhz_J (3D-footprint 20231221), 3fhz_L (3D-footprint 20231221) |
Organisms: | Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | TTTTGCATCGTTATGCAACA |
Type: | Heterodimer |
Binding TFs: | 3fhz_E / 3fhz_F (Arginine repressor, DNA binding domain, Arginine repressor, C-terminal domain) 3fhz_D (Arginine repressor, DNA binding domain, Arginine repressor, C-terminal domain) |
Binding Motifs: | 3fhz_AD TGCATAnngATTMA 3fhz_BF TGAATcnnTAyTCA 3fhz_CE TGAaTAnngATGCA 3fhz_E gATgCA |
Publications: | Cherney L.T, Cherney M.M, Garen C.R, James M.N. The structure of the arginine repressor from Mycobacterium tuberculosis bound with its DNA operator and Co-repressor, L-arginine. Journal of molecular biology 388:85-97 (2009). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.