DNA Binding Site

Accessions: 1ga5_C (3D-footprint 20260701), 1ga5_G (3D-footprint 20260701), 1hlz_C (3D-footprint 20260701)
Organisms: Homo sapiens
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CAACTAGGTCACTAGGTCAG
Type: Heterodimer
Binding TFs: 1ga5_B (Zinc finger, C4 type (two domains))
1ga5_F (Zinc finger, C4 type (two domains))
1hlz_B (Zinc finger, C4 type (two domains))
Binding Motifs: 1ga5_AB AnnAGGTCACnnGGGCA
1ga5_F tGaCC
1hlz_AB TGACCTnnTGACCAnnT
1hlz_B aAnnaGGTCA
Publications: Sierk M.L, Zhao Q, Rastinejad F. DNA deformability as a recognition feature in the reverb response element. Biochemistry 40:12833-43 (2001). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.