DNA Binding Site

Accessions: 3ikt_C (3D-footprint 20250804), 3ikt_D (3D-footprint 20250804)
Organisms: strain HB27 / ATCC BAA-163 / DSM 7039, Thermus thermophilus
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: CGCTGTGAACGCGTTCACAGCG
Binding TFs: 3ikt_B (CoA binding domain, Putative DNA-binding protein N-terminus)
Binding Motifs: 3ikt_AB TGTGAnnnnnnTCACAGC
3ikt_B TCACAGC
Publications: McLaughlin K.J, Strain-Damerell C.M, Xie K, Brekasis D, Soares A.S, Paget M.S, Kielkopf C.L. Structural basis for NADH/NAD+ redox sensing by a Rex family repressor. Molecular cell 38:563-75 (2010). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.