DNA Binding Site
| Accessions: | 2xro_X (3D-footprint 20260701) |
| Organisms: | Pseudomonas putida, strain DOT-T1E |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 42 |
| Sequence: | GAGTATCACATAATGCTACACTCTACCGCATTACGATTCAGC |
| Type: | Heterodimer |
| Binding TFs: | 2xro_E (Bacterial transcriptional regulator, Transcriptional regulator, IclR helix-turn-helix domain, Winged helix-turn-helix DNA-binding) 2xro_F (Bacterial transcriptional regulator, Transcriptional regulator, IclR helix-turn-helix domain, Winged helix-turn-helix DNA-binding) |
| Binding Motifs: | 2xro_ABEF TnTCAnnnnnTGCTAnnnnnTACCGnnnnnCGAnT 2xro_E CGgtA |
| Publications: | Lu D, Fillet S, Meng C, Alguel Y, Kloppsteck P, Bergeron J, Krell T, Gallegos M.T, Ramos J, Zhang X. Crystal structure of TtgV in complex with its DNA operator reveals a general model for cooperative DNA binding of tetrameric gene regulators. Genes & development 24:2556-65 (2010). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.