DNA Binding Site

Accessions: 4jcx_D (3D-footprint 20260701), 4jqd_D (3D-footprint 20260701), 4jqd_H (3D-footprint 20260701)
Organisms: Citrobacter sp. RFL231
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 21
Sequence: TTACTAAGTTTTCCTTAGTGT
Type: Heterodimer
Binding TFs: 4jcx_A / 4jqd_B (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain)
4jcx_B (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain)
4jqd_E (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain)
Binding Motifs: 4jcx_A CTaAGg
4jcx_AB CTAAnTnnnnnTTAG
4jqd_AB CTAAGtnnncCTTAG
4jqd_E ACTTAG
Publications: Shevtsov M.B, Streeter S.D, Thresh S.J, Swiderska A, McGeehan J.E, Kneale G.G. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression. Acta crystallographica. Section D, Biological crystallography 71:398-407 (2015). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.