DNA Binding Site
| Accessions: | 4jcx_D (3D-footprint 20260701), 4jqd_D (3D-footprint 20260701), 4jqd_H (3D-footprint 20260701) |
| Organisms: | Citrobacter sp. RFL231 |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 21 |
| Sequence: | TTACTAAGTTTTCCTTAGTGT |
| Type: | Heterodimer |
| Binding TFs: | 4jcx_A / 4jqd_B (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain) 4jcx_B (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain) 4jqd_E (Helix-turn-helix, Helix-turn-helix domain, Helix-turn-helix domain) |
| Binding Motifs: | 4jcx_A CTaAGg 4jcx_AB CTAAnTnnnnnTTAG 4jqd_AB CTAAGtnnncCTTAG 4jqd_E ACTTAG |
| Publications: | Shevtsov M.B, Streeter S.D, Thresh S.J, Swiderska A, McGeehan J.E, Kneale G.G. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression. Acta crystallographica. Section D, Biological crystallography 71:398-407 (2015). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.