DNA Binding Site
Accessions: | 5ed4_C (3D-footprint 20250804), 5ed4_G (3D-footprint 20250804) |
Organisms: | Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv |
Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 25 |
Sequence: | ATTCACAGCTGATTCACAGCATCTA |
Type: | Heterodimer |
Binding TFs: | 5ed4_A (Response regulator receiver domain, Transcriptional regulatory protein, C terminal) 5ed4_B (Response regulator receiver domain, Transcriptional regulatory protein, C terminal) 5ed4_F (Response regulator receiver domain, Transcriptional regulatory protein, C terminal) |
Binding Motifs: | 5ed4_A AGCTGTGA 5ed4_AB ynCAGcwnnnTCnCAG 5ed4_EF tCnCAGnnnnnTCaCAG |
Publications: | He X, Wang L, Wang S. Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis. Sci Rep : (2016). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.