DNA Binding Site
| Accessions: | 5w43_E (3D-footprint 20260701) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 22 |
| Sequence: | GATTTAGGAAAAATCTTAGATA |
| Binding TFs: | 5w43_B (Response regulator receiver domain, Bacterial regulatory proteins, luxR family, Sigma-70, region 4) |
| Binding Motifs: | 5w43_AB taGGAannmTCTtA 5w43_B taAGA |
| Publications: | Filippova EV, Zemaitaitis B, Aung T, Wolfe AJ, Anderson WF. Structural Basis for DNA Recognition by the Two-Component Response Regulator RcsB. MBio : (2018). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.