DNA Binding Site

Accessions: 1tf6_C (3D-footprint 20260701)
Organisms: Xenopus laevis
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 30
Sequence: GGTCTCCCATCCAGGTACTAACCAGGCCCG
Binding TFs: 1tf6_A (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger)
Binding Motifs: 1tf6_A TGGTnannnnnnkGATGGGAAACC
Publications: Nolte R.T, Conlin R.M, Harrison S.C, Brown R.S. Differing roles for zinc fingers in DNA recognition: structure of a six-finger transcription factor IIIA complex. Proceedings of the National Academy of Sciences of the United States of America 95:2938-43 (1998). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.