DNA Binding Site

Accessions: 4egy_T (3D-footprint 20260701)
Organisms: Bacillus subtilis, strain 168
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: AATATTTGTACGAACAATTT
Binding TFs: 4egy_B (Bacterial regulatory proteins, gntR family, DeoR-like helix-turn-helix domain, HTH domain)
Binding Motifs: 4egy_AB TGyACGAaCA
4egy_B TCgnaCA
Publications: Jain D, Nair D.T. Spacing between core recognition motifs determines relative orientation of AraR monomers on bipartite operators. Nucleic acids research 41:639-47 (2013). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.