DNA Binding Site

Accessions: 2fio_C (3D-footprint 20241219)
Organisms: Bacillus phage phi29
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 41
Sequence: AAAAACGTCAACATTTTATAAAAAAGTCTTGCAAAAAGTTA
Type: Heterodimer
Binding TFs: 2fio_A (Phi-29-like late genes activator (early protein GP4))
2fio_B (Phi-29-like late genes activator (early protein GP4))
Binding Motifs: 2fio_A TGTtg
2fio_AB AaCtnnnnnnnnnnnnnnnnnnnnnnnTGTT
Publications: Badia D, Camacho A, Pérez-Lago L, Escandón C, Salas M, Coll M. The structure of phage phi29 transcription regulator p4-DNA complex reveals an N-hook motif for DNA. Molecular cell 22:73-81 (2006). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.