DNA Binding Site
| Accessions: | 6ycq_D (3D-footprint 20231221) |
| Organisms: | Arabidopsis thaliana |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 21 |
| Sequence: | TTGTCGGCCAAAGGCCGACAA |
| Type: | Heterodimer |
| Binding TFs: | 6ycq_A (B3 DNA binding domain, Auxin response factor) 6ycq_B (B3 DNA binding domain, Auxin response factor) |
| Binding Motifs: | 6ycq_A TTGtCGgC 6ycq_AB TGTCGGtnnnnnGCCGACAA |
| Publications: | Freire-Rios A, Tanaka K, Crespo I, van der Wijk E, Sizentsova Y, Levitsky V, Lindhoud S, Fontana M, Hohlbein J, Boer DR, Mironova V, Weijers D. Architecture of DNA elements mediating ARF transcription factor binding and auxin-responsive gene expression in Arabidopsis. Proc Natl Acad Sci U S A 117:24557-24566 (2020). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.