DNA Binding Site

Accessions: 6c2s_U (3D-footprint 20250804), 6c2s_X (3D-footprint 20250804)
Organisms: Rhodopseudomonas palustris, strain ATCC BAA-98 / CGA009
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 23
Sequence: TATTGTTATACTCTATAACTATA
Binding TFs: 6c2s_C / 6c2s_D (MarR family, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 6c2s_AD ATnnTTATAnnnTATAAnnAT
6c2s_C ATnnTTATA
Publications: Cogan DP, Baraquet C, Harwood CS, Nair SK. Structural basis of transcriptional regulation by CouR, a repressor of coumarate catabolism, in Rhodopseudomonas palustris. J Biol Chem 293:11727-11735 (2018). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.