DNA Binding Site

Accessions: 1je8_C (3D-footprint 20260701), 1je8_D (3D-footprint 20260701), 1je8_G (3D-footprint 20260701), 1je8_H (3D-footprint 20260701)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CGTACCCATTAATGGGTACG
Binding TFs: 1je8_B / 1je8_F (Bacterial regulatory proteins, luxR family, Sigma-70, region 4, Sigma-70, region 4, Winged helix-turn-helix DNA-binding)
Binding Motifs: 1je8_AB TACCnAnnnaTGGGTA
1je8_EF TaCCnAnnnnTnGGtA
1je8_F TnGGtA
Publications: Maris AE., Sawaya MR., Kaczor-Grzeskowiak M., Jarvis MR., Bearson SM., Kopka ML., Schroder I., Gunsalus RP., Dickerson RE. Dimerization allows DNA target site recognition by the NarL response regulator. Nat Struct Biol. 9(10):771-8 (2002). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.