DNA Binding Site

Accessions: 6sdg_C (3D-footprint 20250804)
Organisms: Marchantia aquatica, Marchantia polymorpha (Liverwort)
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 21
Sequence: TTGTCGGCGATTCGCCGACAA
Binding TFs: 6sdg_B (B3 DNA binding domain, Auxin response factor)
Binding Motifs: 6sdg_AB tTGTcGGCnnnnnGCcnACA
6sdg_B tTGTcGGC
Publications: Kato H, Mutte SK, Suzuki H, Crespo I, Das S, Radoeva T, Fontana M, Yoshitake Y, Hainiwa E, van den Berg W, Lindhoud S, Ishizaki K, Hohlbein J, Borst JW, Boer DR, Nishihama R, Kohchi T, Weijers D. Design principles of a minimal auxin response system. Nat Plants 6:473-482 (2020). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.