DNA Binding Site
Accessions: | 1a6y_D (3D-footprint 20250804), 1hlz_D (3D-footprint 20250804) |
Organisms: | Homo sapiens |
Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | CTGACCTAGTGACCTAGTTG |
Type: | Heterodimer |
Binding TFs: | 1a6y_A (Zinc finger, C4 type (two domains)) 1a6y_B (Zinc finger, C4 type (two domains)) 1hlz_B (Zinc finger, C4 type (two domains)) |
Binding Motifs: | 1a6y_A GrCCt 1a6y_AB TGaCCnnnTGACCt 1hlz_AB TGACCTnnTGACCAnnT 1hlz_B aAnnaGGTCA |
Publications: | Zhao Q, Khorasanizadeh S, Miyoshi Y, Lazar M.A, Rastinejad F. Structural elements of an orphan nuclear receptor-DNA complex. Molecular cell 1:849-61 (1998). [Pubmed] Sierk M.L, Zhao Q, Rastinejad F. DNA deformability as a recognition feature in the reverb response element. Biochemistry 40:12833-43 (2001). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.