DNA Binding Site

Accessions: 5ds9_C (3D-footprint 20250804)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 27
Sequence: AAATTAGTTTGAATTTTGAGCTAATTT
Type: Heterodimer
Binding TFs: 5ds9_A (Bacterial regulatory protein, Fis family)
5ds9_B (Bacterial regulatory protein, Fis family)
Binding Motifs: 5ds9_A AGCnCA
5ds9_AB AGCnCAnnnnnCAnACT
Publications: Hancock SP, Stella S, Cascio D, Johnson RC. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. PLoS One : (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.