DNA Binding Site

Accessions: 1ram_C (3D-footprint 20250804), 1ram_D (3D-footprint 20250804)
Organisms: Mus musculus
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CGGCTGGAAATTTCCAGCCG
Binding TFs: 1ram_B (Rel homology domain (RHD))
Binding Motifs: 1ram_AB amnTTCCA
Publications: Chen Y.Q, Ghosh S, Ghosh G. A novel DNA recognition mode by the NF-kappa B p65 homodimer. Nature structural biology 5:67-73 (1998). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.