DNA Binding Site
| Accessions: | 5x5l_C (3D-footprint 20260701), 5x5l_F (3D-footprint 20260701) |
| Organisms: | Acinetobacter baumannii |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | TAAAGTGTGGAGTAAGTGTGGAGA |
| Type: | Heterodimer |
| Binding TFs: | 5x5l_E (Transcriptional regulatory protein, C terminal) 5x5l_H (Transcriptional regulatory protein, C terminal) |
| Binding Motifs: | 5x5l_AE AAnnTGTGGnnnAAGTGnGG 5x5l_BH CAnnnntnnncCAcA 5x5l_H CCACACnTT |
| Publications: | Wen Y, Ouyang Z, Yu Y, Zhou X, Pei Y, Devreese B, Higgins PG, Zheng F. Mechanistic insight into how multidrug resistant Acinetobacter baumannii response regulator AdeR recognizes an intercistronic region. Nucleic Acids Res 45:9773-9787 (2017). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.