DNA Binding Site

Accessions: 3jxc_A (3D-footprint 20231221), 3jxc_B (3D-footprint 20231221)
Organisms: Enterobacteria phage P22
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CATTTAAGATATCTTAAATG
Binding TFs: 3jxc_L / 3jxc_R (Helix-turn-helix, Helix-turn-helix domain, Cro/C1-type HTH DNA-binding domain, Helix-turn-helix domain)
Binding Motifs: 3jxc_L TTAAG
3jxc_LR TTAAGnnnnCTTAA
Publications: Watkins D, Mohan S, Koudelka G.B, Williams L.D. Sequence recognition of DNA by protein-induced conformational transitions. Journal of molecular biology 396:1145-64 (2010). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.