DNA Binding Site

Accessions: 5x6m_C (3D-footprint 20260701), 5x6m_G (3D-footprint 20260701)
Organisms: Mus musculus
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 21
Sequence: TCAGACTGCCGGCAGTCTATA
Type: Heterodimer
Binding TFs: 5x6m_E / 5x6m_F (MH1 domain)
5x6m_B (MH1 domain)
Binding Motifs: 5x6m_AB TGCCGnnAGTCT
5x6m_E CGGCAG
5x6m_EF TGmCgnnaGTCT
Publications: Chai N, Li WX, Wang J, Wang ZX, Yang SM, Wu JW. Structural basis for the Smad5 MH1 domain to recognize different DNA sequences. Nucleic Acids Res 43:9051-64 (2015). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.