DNA Binding Site
| Accessions: | 5x6m_C (3D-footprint 20231221), 5x6m_G (3D-footprint 20231221) |
| Organisms: | Mus musculus |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 21 |
| Sequence: | TCAGACTGCCGGCAGTCTATA |
| Type: | Heterodimer |
| Binding TFs: | 5x6m_E / 5x6m_F (MH1 domain) 5x6m_B (MH1 domain) |
| Binding Motifs: | 5x6m_AB TGCCGnnAGTCT 5x6m_E CGGCAG 5x6m_EF TGmCgnnaGTCT |
| Publications: | Chai N, Li WX, Wang J, Wang ZX, Yang SM, Wu JW. Structural basis for the Smad5 MH1 domain to recognize different DNA sequences. Nucleic Acids Res 43:9051-64 (2015). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.