DNA Binding Site

Accessions: 5v3g_C (3D-footprint 20250804)
Organisms: Homo sapiens
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: GGGCAACGCTCACTGGGGTC
Binding TFs: 5v3g_A (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger, C2H2-type zinc finger)
Binding Motifs: 5v3g_A GGGnAACGCTCACTGGGGTC
Publications: Patel A, Zhang X, Blumenthal RM, Cheng X. Structural basis of human PR/SET domain 9 (PRDM9) allele C-specific recognition of its cognate DNA sequence. J Biol Chem 292:15994-16002 (2017). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.