DNA Binding Site
| Accessions: | 1xs9_C (3D-footprint 20231221) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | ATGCCACGTTTTGCTAAATC |
| Binding TFs: | 1xs9_A (Bacterial regulatory helix-turn-helix proteins, AraC family, Helix-turn-helix domain) |
| Binding Motifs: | 1xs9_A tGCCannnnnTGnnAA |
| Publications: | Dangi B, Gronenborn A.M, Rosner J.L, Martin R.G. Versatility of the carboxy-terminal domain of the alpha subunit of RNA polymerase in transcriptional activation: use of the DNA contact site as a protein contact site for MarA. Molecular microbiology 54:45-59 (2004). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.