DNA Binding Site
Accessions: | 1h6f_C (3D-footprint 20241219), 1h6f_D (3D-footprint 20241219), 4a04_D (3D-footprint 20241219), 4a04_E (3D-footprint 20241219) |
Organisms: | Homo sapiens |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 22 |
Sequence: | ATTTCACACCTAGGTGTGAAAT |
Type: | Heterodimer |
Binding TFs: | 1h6f_B (T-box) 4a04_B (T-box) |
Binding Motifs: | 1h6f_AB TnnnCACctAGgTGnnnA 1h6f_B gTGnnnA 4a04_AB TnnnCACcnaGgTGnnnA |
Publications: | Coll M, Seidman J.G, Müller C.W. Structure of the DNA-bound T-box domain of human TBX3, a transcription factor responsible for ulnar-mammary syndrome. Structure (London, England : 1993) 10:343-56 (2002). [Pubmed] El Omari K, De Mesmaeker J, Karia D, Ginn H, Bhattacharya S, Mancini E.J. Structure of the DNA-bound T-box domain of human TBX1, a transcription factor associated with the DiGeorge syndrome. Proteins : (2011). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.