DNA Binding Site

Accessions: 5i2d_U (3D-footprint 20260701)
Organisms: strain HB8 / ATCC 27634 / DSM 579, Thermus thermophilus
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 66
Sequence: GCATCCGTGAGTCGAGGGTAATAACGGCAACGGACGGGCCTTGACTGTGAGGTGGCTCAC
AAGGGC
Binding TFs: 5i2d_R (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain)
Binding Motifs: 5i2d_R tCAcA
Publications: Feng Y, Zhang Y, Ebright RH. Structural basis of transcription activation. Science 352:1330-3 (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.