DNA Binding Site

Accessions: 4s05_C (3D-footprint 20241219)
Organisms: Klebsiella pneumoniae JM45
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: ATTTCTTAATATTATCCTAAGCAAG
Binding TFs: 4s05_A / 4s05_B (Response regulator receiver domain, Transcriptional regulatory protein, C terminal)
Binding Motifs: 4s05_A TtAAt
4s05_AB CtTAGnnnannATTaA
Publications: Lou YC, Weng TH, Li YC, Kao YF, Lin WF, Peng HL, Chou SH, Hsiao CD, Chen C. Structure and dynamics of polymyxin-resistance-associated response regulator PmrA in complex with promoter DNA. Nat Commun : (2015). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.