DNA Binding Site

Accessions: 3dzu_F (3D-footprint 20231221), 3dzy_F (3D-footprint 20231221), 3e00_F (3D-footprint 20231221)
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CTGACCTTTGACCTAGTTTG
Type: Heterodimer
Binding TFs: 3dzu_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains))
3dzy_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains))
3e00_A (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains))
3e00_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains))
Binding Motifs: 3dzu_AD AannaGGTnannGGTCA
3dzu_D AAAnnAGGTcA
3dzy_AD TGnCnnnTGACCTnnnTT
3dzy_D TGACCtnnnTT
3e00_A TGaCC
3e00_AD aAnnnAGGTCAnnGGnCA
Publications: Chandra V, Huang P, Hamuro Y, Raghuram S, Wang Y, Burris T.P, Rastinejad F. Structure of the intact PPAR-gamma-RXR- nuclear receptor complex on DNA. Nature 456:350-6 (2008). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.