DNA Binding Site
| Accessions: | 3dzu_F (3D-footprint 20260701), 3dzy_F (3D-footprint 20260701), 3e00_F (3D-footprint 20260701) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | CTGACCTTTGACCTAGTTTG |
| Type: | Heterodimer |
| Binding TFs: | 3dzu_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains)) 3dzy_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains)) 3e00_A (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains)) 3e00_D (Ligand-binding domain of nuclear hormone receptor, Zinc finger, C4 type (two domains)) |
| Binding Motifs: | 3dzu_AD AannaGGTnannGGTCA 3dzu_D AAAnnAGGTcA 3dzy_AD TGnCnnnTGACCTnnnTT 3dzy_D TGACCtnnnTT 3e00_A TGaCC 3e00_AD aAnnnAGGTCAnnGGnCA |
| Publications: | Chandra V, Huang P, Hamuro Y, Raghuram S, Wang Y, Burris T.P, Rastinejad F. Structure of the intact PPAR-gamma-RXR- nuclear receptor complex on DNA. Nature 456:350-6 (2008). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.