DNA Binding Site
| Accessions: | 5ei9_D (3D-footprint 20260701) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | GGCCTCCCTAGCCACGTGGA |
| Binding TFs: | 5ei9_F (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger, C2H2-type zinc finger) |
| Binding Motifs: | 5ei9_F tGGCTAGGGAGGCa |
| Publications: | Patel A, Horton JR, Wilson GG, Zhang X, Cheng X. Structural basis for human PRDM9 action at recombination hot spots. Genes Dev 30:257-65 (2016). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.