DNA Binding Site
| Accessions: | 3jrg_D (3D-footprint 20250804) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 27 |
| Sequence: | AAATTTGCTGAAAATTCCAACAAATTT |
| Binding TFs: | 3jrg_B (Bacterial regulatory protein, Fis family) |
| Binding Motifs: | 3jrg_AB TGTnGGnnnnnTCnGCA 3jrg_B cnaCA |
| Publications: | Stella S, Cascio D, Johnson R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes & development 24:814-26 (2010). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.