DNA Binding Site
| Accessions: | 1hbx_W (3D-footprint 20250804), 1hbx_X (3D-footprint 20250804) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 25 |
| Sequence: | ACACCGGAAGTCCTAATTAGGCCAT |
| Type: | Heterodimer |
| Binding TFs: | 1hbx_A (SRF-type transcription factor (DNA-binding and dimerisation domain)) 1hbx_G (Ets-domain) 1hbx_H (Ets-domain) |
| Binding Motifs: | 1hbx_G ttCCG 1hbx_A TTAGGAnnT 1hbx_ABG CGGAAnTCCTAATTAG 1hbx_DEH CTAATTAGsanTTCCG |
| Publications: | Hassler M., Richmond T. J. The B-box dominates SAP-1-SRF interactions in the structure of the ternary complex.. EMBO J. 20:3018-3028 (2001). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.