DNA Binding Site

Accessions: 2o6g_D (3D-footprint 20250804)
Organisms: Homo sapiens
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 56
Sequence: AAATGACATAGGGAAACTGAAAGGGAAAGTGAAAGTGGGAAATTCCTCTGAATAGA
Type: Heterodimer
Binding TFs: 2o6g_E (Interferon regulatory factor transcription factor)
2o6g_H (Interferon regulatory factor transcription factor)
Binding Motifs: 2o6g_E TTTcCnnaT
2o6g_EFGH GGArAnTGAAAGGGAAAnTnAA
Publications: Panne D, Maniatis T, Harrison S.C. An atomic model of the interferon-beta enhanceosome. Cell 129:1111-23 (2007). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.