DNA Binding Site
Accessions: | 4yg1_F (3D-footprint 20241219) |
Organisms: | Escherichia coli, strain K12 |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 46 |
Sequence: | TTATCCGCTAAGGGGATATTATAAGTTTTATCCTTTAGGAGGATAA |
Type: | Heterodimer |
Binding TFs: | 4yg1_B (Helix-turn-helix, Helix-turn-helix domain, Cro/C1-type HTH DNA-binding domain, Helix-turn-helix domain, Helix-turn-helix domain) 4yg1_D (Helix-turn-helix, Helix-turn-helix domain, Cro/C1-type HTH DNA-binding domain, Helix-turn-helix domain, Helix-turn-helix domain) |
Binding Motifs: | 4yg1_ABCD TATCnnnnnnnATGnTAnnnnnnnnnnnATnCnnnnnnCGGATA 4yg1_B GATA |
Publications: | Schumacher MA, Balani P, Min J, Chinnam NB, Hansen S, Vulić M, Lewis K, Brennan RG. HipBA-promoter structures reveal the basis of heritable multidrug tolerance. Nature 524:59-64 (2015). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.