DNA Binding Site

Accessions: 5tw1_P (3D-footprint 20241219), 6m7j_P (3D-footprint 20241219), 6vvs_P (3D-footprint 20241219), 6vvt_P (3D-footprint 20241219), 6vvv_P (3D-footprint 20241219)
Organisms: Mycobacterium smegmatis, Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155), Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 26
Sequence: AGCACAATTTAACACTTTTGTCAAGC
Type: Heterodimer
Binding TFs: 6m7j_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
5tw1_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
6vvs_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
6vvt_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
6vvv_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
Binding Motifs: 5tw1_F CTTGACAnnnnnnnnnnnnTnTGCT
6m7j_F AGCanAnnnnnnnnnnnntGTCAAG
6vvs_F CTTGACAnnnnnnnnnnnnTnTGCT
6vvs_FT AGCAnAnnnnnnnncnnnTGTCaAG
6vvt_F AGCAnAnnnnnnnnnnnnTGTCAAG
6vvv_F CTTGACAnnnnnnnnnnnnTnTGCT
6vvv_FT AGCAnAnnnnnnnnnnnnTGTCAAG
Publications: Hubin EA, Fay A, Xu C, Bean JM, Saecker RM, Glickman MS, Darst SA, Campbell EA. Structure and function of the mycobacterial transcription initiation complex with the essential regulator RbpA. Elife : (2017). [Pubmed]

Boyaci H, Chen J, Jansen R, Darst SA, Campbell EA. Structures of an RNA polymerase promoter melting intermediate elucidate DNA unwinding. Nature 565:382-385 (2019). [Pubmed]

Lilic M, Chen J, Boyaci H, Braffman N, Hubin EA, Herrmann J, Müller R, Mooney R, Landick R, Darst SA, Campbell EA. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc Natl Acad Sci U S A 117:30423-30432 (2020). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.