DNA Binding Site

Accessions: 4nhj_C (3D-footprint 20231221)
Organisms: Klebsiella pneumoniae subsp. pneumoniae, strain ATCC 700721 / MGH 78578
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: GTTGTACATTCCGTTACTCCCT
Type: Heterodimer
Binding TFs: 4nhj_A (Transcriptional regulatory protein, C terminal)
4nhj_B (Transcriptional regulatory protein, C terminal)
Binding Motifs: 4nhj_A GAaTGTACA
4nhj_AB TGtACAnnCCGTkrCT
Publications: Li Y.C, Chang C.K, Chang C.F, Cheng Y.H, Fang P.J, Yu T, Chen S.C, Li Y.C, Hsiao C.D, Huang T.H. Structural dynamics of the two-component response regulator RstA in recognition of promoter DNA element. Nucleic acids research 42:8777-88 (2014). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.