DNA Binding Site
| Accessions: | 3wgi_G (3D-footprint 20231221), 3wgi_H (3D-footprint 20231221) |
| Organisms: | Thermoanaerobacter ethanolicus JW 200 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 22 |
| Sequence: | GATTGTTAATCGATTAACAATC |
| Binding TFs: | 3wgi_D (CoA binding domain, Putative DNA-binding protein N-terminus) |
| Binding Motifs: | 3wgi_CD TTGTTAAnnnnTTAACAA 3wgi_D TTGTTAA |
| Publications: | Zheng Y, Ko TP, Sun H, Huang CH, Pei J, Qiu R, Wang AH, Wiegel J, Shao W, Guo RT. Distinct structural features of Rex-family repressors to sense redox levels in anaerobes and aerobes. J Struct Biol 188:195-204 (2014). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.