DNA Binding Site
| Accessions: | 3l1p_M (3D-footprint 20231221) |
| Organisms: | Mus musculus |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 22 |
| Sequence: | TCCATTTGCCTTTCAAATGTGG |
| Type: | Heterodimer |
| Binding TFs: | 3l1p_A (Homeobox domain, Pou domain - N-terminal to homeobox domain) 3l1p_B (Homeobox domain, Pou domain - N-terminal to homeobox domain) |
| Binding Motifs: | 3l1p_A CATTTsAAA 3l1p_AB CATTTGCCTTTCAAATG |
| Publications: | Esch D, Vahokoski J, Groves M.R, Pogenberg V, Cojocaru V, Vom Bruch H, Han D, Drexler H.C, Araúzo-Bravo M.J, Ng C.K, Jauch R, Wilmanns M, Schöler H.R. A unique Oct4 interface is crucial for reprogramming to pluripotency. Nature cell biology 15:295-301 (2013). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.