DNA Binding Site
| Accessions: | 1mnm_F (3D-footprint 20231221) |
| Organisms: | Saccharomyces cerevisiae, Saccharomyces cerevisiae (strain ATCC 204508 / S288c) |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 25 |
| Sequence: | CGTGTAAATTTCCCTATTAGGTAAT |
| Type: | Heterodimer |
| Binding TFs: | 1mnm_A (SRF-type transcription factor (DNA-binding and dimerisation domain)) 1mnm_C / 1mnm_D (Homeobox domain, Homeobox KN domain) |
| Binding Motifs: | 1mnm_A TaGg 1mnm_ABCD ATTrCCTAnnnnGGAAATTTACAA 1mnm_C ATTTACAa |
| Publications: | Tan S, Richmond T.J. Crystal structure of the yeast MATalpha2/MCM1/DNA ternary complex. Nature 391:660-6 (1998). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.