DNA Binding Site

Accessions: 1bl0_B (3D-footprint 20241219)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: GGATTTAGCAAAACGTGGCATC
Binding TFs: 1bl0_A (Bacterial regulatory helix-turn-helix proteins, AraC family, Helix-turn-helix domain)
Binding Motifs: 1bl0_A TTnGCAnnnnGTGGC
Publications: Rhee S., Martin RG., Rosner JL., Davies DR. A novel DNA-binding motif in MarA: the first structure for an AraC family transcriptional activator. Proc Natl Acad Sci U S A. 95(18):10413-8 (1998). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.