DNA Binding Site

Accessions: tagD_3 (DBTBS 1.0)
Names: tagD_3
Organisms: Bacillus subtilis
Libraries: DBTBS 1.0 1
1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed]
Length: 28
Sequence: tgtttttaatagtgtttaacattaggaa
Binding TFs: PhoP (Response regulator receiver domain, Transcriptional regulatory protein, C terminal)
Binding Motifs: PhoP mhTGTwAAgAwrwkwtrW
Publications: Liu W, Eder S, Hulett F.M. Analysis of Bacillus subtilis tagAB and tagDEF expression during phosphate starvation identifies a repressor role for PhoP-P. Journal of bacteriology 180:753-8 (1998). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.