DNA Binding Site
| Accessions: | 3iyd_I (3D-footprint 20260701) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 98 |
| Sequence: | CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCC GGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG |
| Binding TFs: | 3iyd_H (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain) |
| Binding Motifs: | 3iyd_H AnnnnTGTGaT |
| Publications: | Hudson B.P, Quispe J, Lara-González S, Kim Y, Berman H.M, Arnold E, Ebright R.H, Lawson C.L. Three-dimensional EM structure of an intact activator-dependent transcription initiation complex. Proceedings of the National Academy of Sciences of the United States of America 106:19830-5 (2009). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.