DNA Binding Site
Accessions: | iolR_2 (DBTBS 1.0) |
Names: | iolR_2 |
Organisms: | Bacillus subtilis |
Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
Length: | 22 |
Sequence: | actattgattaacttttggttt |
Binding TFs: | IolR (DeoR C terminal sensor domain, DeoR-like helix-turn-helix domain, HTH domain, FeoC like transcriptional regulator) |
Binding Motifs: | IolR_1 ACCAA IolR_2 mhCWA |
Publications: | Yoshida K.I, Shibayama T, Aoyama D, Fujita Y. Interaction of a repressor and its binding sites for regulation of the Bacillus subtilis iol divergon. Journal of molecular biology 285:917-29 (1999). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.