DNA Binding Site

Accessions: 6pw2_H (3D-footprint 20260701)
Organisms: Epstein-Barr virus (strain B95-8) (HHV-4), Human herpesvirus 4
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 45
Sequence: AATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAT
Binding TFs: 6pw2_L (Epstein Barr virus nuclear antigen-1, DNA-binding domain)
Binding Motifs: 6pw2_IJKL AATAGCATnTnTTACCCnnnGGGAAGCnnnnGnTAT
Publications: Malecka KA, Dheekollu J, Deakyne JS, Wiedmer A, Ramirez UD, Lieberman PM, Messick TE. Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr Virus Dyad Symmetry Minimal Origin of Replication. J Virol : (2019). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.