DNA Binding Site
Accessions: | 1gji_D (3D-footprint 20250804) |
Organisms: | Gallus gallus |
Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | TCTGGAATTTCTTTAAACCC |
Binding TFs: | 1gji_A / 1gji_B (Rel homology domain (RHD)) |
Binding Motifs: | 1gji_A yTCCm 1gji_AB GGATnTTC |
Publications: | Huang D.B, Chen Y.Q, Ruetsche M, Phelps C.B, Ghosh G. X-ray crystal structure of proto-oncogene product c-Rel bound to the CD28 response element of IL-2. Structure (London, England : 1993) 9:669-78 (2001). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.